Recherche de gènes et régions codantes





télécharger 480.38 Kb.
titreRecherche de gènes et régions codantes
page14/15
date de publication13.02.2018
taille480.38 Kb.
typeRecherche
d.20-bal.com > droit > Recherche
1   ...   7   8   9   10   11   12   13   14   15

Pour en savoir plus sur l’utilisation de Phylip


Mode de fonctionnement des différents logiciels inclus dans le package PHYLIP

Principes généraux :
Tous les programmes s'utilisent en tapant la commande
Fichiers de séquences : au format PHYLIP (entrelacés)

Passage par READSEQ (ou sortie de CLUSTALW)
Les programmes lisent TOUJOURS un fichier infile

Les programmes génèrent les fichiers

outfile résultats

treefile fichiers de représentations des topologies (parenthésées)

plotfile fichier graphique
Comme les programmes utilisent les sorties de programmes comme

entrées d'autres, il est INDISPENSABLE de renommer les fichiers

outfile (en infile) à chaque étape

Parcimonie
dnapars (acides nucléiques) ou protpars (proteines)

Nécessité de fichiers PHYLIP (de séquences alignées)

utilisation de l'option de fichiers PHYLIP en sortie de CLUSTALW
Your choice: 9
********* Format of Alignment Output *********
1. Toggle CLUSTAL format output = ON

2. Toggle NBRF/PIR format output = OFF

3. Toggle GCG/MSF format output = OFF

4. Toggle PHYLIP format output = ON

5. Toggle GDE format output = OFF
6. Toggle GDE output case = LOWER

7. Toggle output order = INPUT FILE
8. Create alignment output file(s) now?
9. Toggle parameter output = OFF
H. HELP
fichier.aln

CLUSTAL W(1.6) multiple sequence alignment
CHKHBA_J00 ----------------------ACACAGAGGTGCAACCATGGTGCTGTCCGCTGCTGACA

DUKHBADWP CGCAACCCCGTCAGTTGCCAGCCTGCCACACCGCTGCCGCCATGCTGACCGCCGAGGACA

SMRHBAA_M1 -------------------------AACCACCGCAAACATGAAGCTGACTGCCGAAGATA

XELHBA_J00 -----------------TGCACAACACAAACAGGAACCATGCTTCTTTCAGCCGATGACA

DAVAGL_M14 -----------------------------------------GTGCTCTCGGATGCTGACA

** * * * ** *
CHKHBA_J00 AGAACAACGTCAAGGGCATCTTCACCAAAATCGCCGGCCATGCTGAGGAGTATGGCGCCG

DUKHBADWP AGAAGCTCATCACGCAGTTGTGGGAGAAGGTGGCTGGCCACCAGGAGGAATTCGGAAGTG

SMRHBAA_M1 AACATAATGTGAAGGCCATCTGGGATCATGTCAAAGGACATGAAGAGGCGATTGGTGCAG

XELHBA_J00 AGAAACACATCAAGGCAATTATGCCTCCTATCGCTGCCCATGGCGACAAATTTGGGGGAG

DAVAGL_M14 AGACTCACGTGAAAGCCATCTGGGGTAAGGTGGGAGGCCACGCCGGTGCCTACGCAGCTG

* * * * * * ** * * *

fichier.phy
lovelace$ more tofasta.phy

5 589

CHKHBA_J00 ---------- ---------- --ACACAGAG GTGCAACCAT GGTGCTGTCC

DUKHBADWP CGCAACCCCG TCAGTTGCCA GCCTGCCACA CCGCTGCCGC CATGCTGACC

SMRHBAA_M1 ---------- ---------- -----AACCA CCGCAAACAT GAAGCTGACT

XELHBA_J00 ---------- -------TGC ACAACACAAA CAGGAACCAT GCTTCTTTCA

DAVAGL_M14 ---------- ---------- ---------- ---------- -GTGCTCTCG
GCTGCTGACA AGAACAACGT CAAGGGCATC TTCACCAAAA TCGCCGGCCA

GCCGAGGACA AGAAGCTCAT CACGCAGTTG TGGGAGAAGG TGGCTGGCCA

GCCGAAGATA AACATAATGT GAAGGCCATC TGGGATCATG TCAAAGGACA

GCCGATGACA AGAAACACAT CAAGGCAATT ATGCCTCCTA TCGCTGCCCA

GATGCTGACA AGACTCACGT GAAAGCCATC TGGGGTAAGG TGGGAGGCCA
TGCTGAGGAG TATGGCGCCG AGACCTTGGA AAGGATGTTC ACCACCTACC

CCAGGAGGAA TTCGGAAGTG AAGCTCTGCA GAGGATGTTC CTCGCCTACC

TGAAGAGGCG ATTGGTGCAG AAGCTCTTTA CAGGATGTTC TGTTGTATGC

TGGCGACAAA TTTGGGGGAG AAGCTTTGTA CAGGATGTTC ATAGTCAACC

CGCCGGTGCC TACGCAGCTG AAGCTCTTGC CAGAACCTTC CTCTCCTTCC
lovelace$ protpars

protpars: can't read infile

Please enter a new filename>fmts.phy
Protein parsimony algorithm, version 3.55c
Setting for this run:

U Search for best tree? Yes

J Randomize input order of sequences? No. Use input order

O Outgroup root? No, use as outgroup species 1

T Use Threshold parsimony? No, use ordinary parsimony

M Analyze multiple data sets? No

I Input sequences interleaved? Yes

0 Terminal type (IBM PC, VT52, ANSI)? ANSI

1 Print out the data at start of run No

2 Print indications of progress of run Yes

3 Print out tree Yes

4 Print out steps in each site No

5 Print sequences at all nodes of tree No

6 Write out trees onto tree file? Yes
Are these settings correct? (type Y or the letter for one to change)
Y
Adding species:

CHKHBA_J00

DUKHBADWP

SMRHBAA_M1

XELHBA_J00

DAVAGL_M14
Doing global rearrangements

!---------!

.........
Output written to output file
Trees also written onto file
l

Protein parsimony algorithm, version 3.55c


One most parsimonious tree found:

+-----XELHBA_J00

+--3

! ! +--DAVAGL_M14

+--2 +--4

! ! +--SMRHBAA_M1

--1 !

! +--------DUKHBADWP

!

+-----------CHKHBA_J00
remember: this is an unrooted tree!

requires a total of 1400.000
lovelace$ more treefile

(((XELHBA_J00,(DAVAGL_M14,SMRHBAA_M1)),DUKHBADWP),CHKHBA_J00);

lovelace$
arbre sans distances
Distances
lovelace$ dnadist

dnadist: can't read infile

Please enter a new filename>tofasta.phy
Nucleic acid sequence Distance Matrix program, version 3.55c
Settings for this run:

D Distance (Kimura, Jin/Nei, ML, J-C)? Kimura 2-parameter

T Transition/transversion ratio? 2.0

C One category of substitution rates? Yes

L Form of distance matrix? Square

M Analyze multiple data sets? No

I Input sequences interleaved? Yes

0 Terminal type (IBM PC, VT52, ANSI)? ANSI

1 Print out the data at start of run No

2 Print indications of progress of run Yes
Are these settings correct? (type Y or letter for one to change)
Y
Distances calculated for species

CHKHBA_J00 ....

DUKHBADWP ...

SMRHBAA_M1 ..

XELHBA_J00 .

DAVAGL_M14
Distances written to file
lovelace$ more outfile

5

CHKHBA_J00 0.0000 0.5962 0.9649 0.7203 0.6094

DUKHBADWP 0.5962 0.0000 1.0130 0.7741 0.5435

SMRHBAA_M1 0.9649 1.0130 0.0000 0.9289 0.9209

XELHBA_J00 0.7203 0.7741 0.9289 0.0000 0.8969

DAVAGL_M14 0.6094 0.5435 0.9209 0.8969 0.0000
lovelace$mv outfile infile
lovelace$ fitch
Fitch-Margoliash method version 3.55c
Settings for this run:

U Search for best tree? Yes

P Power? 2.00000

- Negative branch lengths allowed? No

O Outgroup root? No, use as outgroup species 1

L Lower-triangular data matrix? No

R Upper-triangular data matrix? No

S Subreplicates? No

G Global rearrangements? No

J Randomize input order of species? No. Use input order

M Analyze multiple data sets? No

0 Terminal type (IBM PC, VT52, ANSI)? ANSI

1 Print out the data at start of run No

2 Print indications of progress of run Yes

3 Print out tree Yes

4 Write out trees onto tree file? Yes
Are these settings correct? (type Y or the letter for one to change)

y
Adding species:

CHKHBA_J00

DUKHBADWP

SMRHBAA_M1

XELHBA_J00

DAVAGL_M14
Output written to output file
Tree also written onto file
lovelace$ more outfile
5 Populations
Fitch-Margoliash method version 3.55c
__ __ 2

\ \ (Obs - Exp)

Sum of squares = /_ /_ ------------

2

i j Obs
Negative branch lengths not allowed

+----------------DAVAGL_M14

+---3

! +--------------DUKHBADWP

!

! +----------------------XELHBA_J00

--1-----2

! +--------------------------------SMRHBAA_M1

!

+---------------CHKHBA_J00

remember: this is an unrooted tree!
Sum of squares = 0.03950
Average percent standard deviation = 4.68447
examined 15 trees
Between And Length

------- --- ------

1 3 0.06233

3 DAVAGL_M14 0.28139

3 DUKHBADWP 0.26211

1 2 0.09924

2 XELHBA_J00 0.37775

2 SMRHBAA_M1 0.55115

1 CHKHBA_J00 0.26879

lovelace$ more treefile

((DAVAGL_M14:0.28139,DUKHBADWP:0.26211):0.06233,(XELHBA_J00:0.37775,

SMRHBAA_M1:0.55115):0.09924,CHKHBA_J00:0.26879);

lovelace$

lovelace$ neighbor
Neighbor-Joining/UPGMA method version 3.5
Settings for this run:

N Neighbor-joining or UPGMA tree? Neighbor-joining

O Outgroup root? No, use as outgroup species 1

L Lower-triangular data matrix? No

R Upper-triangular data matrix? No

S Subreplicates? No

J Randomize input order of species? No. Use input order

M Analyze multiple data sets? No

0 Terminal type (IBM PC, VT52, ANSI)? ANSI

1 Print out the data at start of run No

2 Print indications of progress of run Yes

3 Print out tree Yes

4 Write out trees onto tree file? Yes
Are these settings correct? (type Y or the letter for one to change)

y
CYCLE 2: OTU 3 ( 0.54903) JOINS OTU 4 ( 0.37987)

CYCLE 1: OTU 1 ( 0.27209) JOINS NODE 3 ( 0.10606)

LAST CYCLE:

NODE 1 ( 0.05896) JOINS OTU 2 ( 0.26461) JOINS OTU 5 ( 0.27889)
Output written on output file
Tree written on tree file

lovelace$ more outfile
5 Populations
Neighbor-Joining/UPGMA method version 3.55c

Neighbor-joining method
Negative branch lengths allowed

+---------------DUKHBADWP

!

--3----------------DAVAGL_M14

!

! +---------------CHKHBA_J00

+---2

! +--------------------------------SMRHBAA_M1

+-----1

+----------------------XELHBA_J00

remember: this is an unrooted tree!
Between And Length

------- --- ------

3 DUKHBADWP 0.26461

3 DAVAGL_M14 0.27889

3 2 0.05896

2 CHKHBA_J00 0.27209

2 1 0.10606

1 SMRHBAA_M1 0.54903

1 XELHBA_J00 0.37987
lovelace$ more treefile

(DUKHBADWP:0.26461,DAVAGL_M14:0.27889,(CHKHBA_J00:0.27209,

(SMRHBAA_M1:0.54903,XELHBA_J00:0.37987):0.10606):0.05896);

lovelace$
lovelace$ kitsch
Fitch-Margoliash method with contemporary tips, version 3.55c
Settings for this run:

U Search for best tree? Yes

P Power? 2.00000

- Negative branch lengths allowed? No

L Lower-triangular data matrix? No

R Upper-triangular data matrix? No

S Subreplicates? No

J Randomize input order of species? No. Use input order

M Analyze multiple data sets? No

0 Terminal type (IBM PC, VT52, ANSI)? ANSI

1 Print out the data at start of run No

2 Print indications of progress of run Yes

3 Print out tree Yes

4 Write out trees onto tree file? Yes
Are these settings correct? (type Y or the letter for one to change)

y
Adding species:

CHKHBA_J00

DUKHBADWP

SMRHBAA_M1

XELHBA_J00

DAVAGL_M14
Doing global rearrangements

!---------!

.........
Output written to output file
Tree also written onto file
lovelace$ more outfile
5 Populations
Fitch-Margoliash method with contemporary tips, version 3.55c
__ __ 2

\ \ (Obs - Exp)

Sum of squares = /_ /_ ------------

2

i j Obs
negative branch lengths not allowed

+---------------DAVAGL_M14

+--4

+-----1 +---------------DUKHBADWP

! !

+----3 +-----------------CHKHBA_J00

! !

--2 +-----------------------XELHBA_J00

!

+----------------------------SMRHBAA_M1
Sum of squares = 0.059
Average percent standard deviation = 5.73593
examined 72 trees
From To Length Time

---- -- ------ ----
4 DAVAGL_M14 0.27175 0.47712

1 4 0.02958 0.20537

4 DUKHBADWP 0.27175 0.47712

3 1 0.09078 0.17580

1 CHKHBA_J00 0.30133 0.47712

2 3 0.08501 0.08501

3 XELHBA_J00 0.39211 0.47712

2 SMRHBAA_M1 0.47712 0.47712
lovelace$ more treefile

((((DAVAGL_M14:0.27175,DUKHBADWP:0.27175):0.02958,CHKHBA_J00:0.30133):0.09078,

XELHBA_J00:0.39211):0.08501,SMRHBAA_M1:0.47712);


lovelace$ dnaml
Nucleic acid sequence Maximum Likelihood method, version 3.55c
Settings for this run:

U Search for best tree? Yes

T Transition/transversion ratio: 2.0000

F Use empirical base frequencies? Yes

C One category of substitution rates? Yes

G Global rearrangements? No

J Randomize input order of sequences? No. Use input order

O Outgroup root? No, use as outgroup species 1

M Analyze multiple data sets? No

I Input sequences interleaved? Yes

0 Terminal type (IBM PC, VT52, ANSI)? ANSI

1 Print out the data at start of run No

2 Print indications of progress of run Yes

3 Print out tree Yes

4 Write out trees onto tree file? Yes
Are these settings correct? (type Y or the letter for one to change)

Y

Adding species:

CHKHBA

DUKHBADWP

SMRHBAA

XELHBA

DAVAGL

Output written to output file
Tree also written onto file
lovelace$ more outfile

Nucleic acid sequence Maximum Likelihood method, version 3.55c
Empirical Base Frequencies:
A 0.25368

C 0.29449

G 0.23346

T(U) 0.21838
Transition/transversion ratio = 2.000000
(Transition/transversion parameter = 1.523022)

+--------------DAVAGL

+-----3

! +-----------------DUKHBADWP

!

! +--------------------XELHBA

--1---------2

! +-------------------------------SMRHBAA

!

+--------------CHKHBA

remember: this is an unrooted tree!
Ln Likelihood = -3145.55232
Examined 15 trees
Between And Length Approx. Confidence Limits

------- --- ------ ------- ---------- ------
1 3 0.09292 ( 0.03404, 0.15218) **

3 DAVAGL 0.26355 ( 0.19312, 0.33542) **

3 DUKHBADWP 0.30752 ( 0.23199, 0.38496) **

1 2 0.16329 ( 0.09148, 0.23605) **

2 XELHBA 0.34539 ( 0.25789, 0.43510) **

2 SMRHBAA 0.53168 ( 0.42197, 0.64816) **

1 CHKHBA 0.25619 ( 0.18690, 0.32797) **
* = significantly positive, P < 0.05

** = significantly positive, P < 0.01

lovelace$ more treefile

((DAVAGL:0.26355,DUKHBADWP:0.30752):0.09292,(XELHBA:0.34539,

SMRHBAA:0.53168):0.16329,CHKHBA:0.25619);

lovelace$


lovelace$ more fmt.phy

5 340

ECFMT_2 MSESLRIIFA GTPDFAARHL DALLS-SGHN VVGVFTQPDR PAGRGKKLMP

HI32745_2 -MKSLNIIFA GTPDFAAQHL QAILN-SQHN VIAVYTQPDK PAGRGKKLQA

TTDEFFMT_3 ----MRVAFF GTPLWAVPVL DALR--KRHQ VVLVVSQPDK PQGRGLRPAP

MG39721_2 ---MFKIVFF GTSTLSKKCL EQLFYDNDFE ICAVVTQPDK INHRNNKIVP

SSCPNC ---MMKTVFF GTPDFAVPTL EALLGHPDID VLAVVSQPDR RRGRGSKLIP
SPVKVLAEEK GLPVFQP-VS LRPQENQQLV AELQADVMVV VAYGLILPKA

SPVKQLAEQN NIPVYQP-KS LRKEEAQSEL KALNADVMVV VAYGLILPKA

SPVARYAEAE GLPLLRP-AR LREEAFLEAL RQAAPEVAVV AAYGKLIPKE

SDVKSFCLEK NITFFQP--K QS-ISIKADL EKLKADIGIC VSFGQYLHQD

SPVKEVAVQA GIPVWQPERV KRCQETLAKL KNCQADFFVV VAYGQLLSPE
lovelace$ seqboot
lovelace$ cp fmt.phy infile

lovelace$ seqboot
Random number seed (must be odd)?
1   ...   7   8   9   10   11   12   13   14   15

similaire:

Recherche de gènes et régions codantes iconRecherche année 2009/2010 Titre du stage
«Flux des (trans-)gènes et impact sur la biodiversité» ‘gmbioImpact’ (2007-2010)

Recherche de gènes et régions codantes icon«Titre de l’étude»
«indiquer la nature des prélèvements (sang, urine, moelle,adn, etc)» et notamment le fait qu’il s’agit d’étudier «les modifications...

Recherche de gènes et régions codantes iconLe transfert aux régions des biens immobiliers de l’Afpa appartenant...

Recherche de gènes et régions codantes iconRecherche L’alphabet français semble mieux convenir à la fonction...

Recherche de gènes et régions codantes iconRecherche L’alphabet français semble mieux convenir à la fonction...

Recherche de gènes et régions codantes iconRecherche L’alphabet français semble mieux convenir à la fonction...

Recherche de gènes et régions codantes iconLa Recherche Scientifique
...

Recherche de gènes et régions codantes iconRecherche à visée médicale: L'article 23 de l'actuel projet de loi,...
«autorisation implicite» et «favoriser les besoins de l'industrie de la procréation»

Recherche de gènes et régions codantes iconLa loi n° 2015-29 du 16 janvier 2015 relative à la délimitation des...

Recherche de gènes et régions codantes iconDecentralisation de l’action sociale et protection de l’enfance
«relative aux droits et libertés des communes, des départements et des régions»






Tous droits réservés. Copyright © 2016
contacts
d.20-bal.com